Stem-loop sequence dvi-mir-9716

AccessionMI0030980 (change log)
DescriptionDrosophila virilis miR-9716 stem-loop
Stem-loop
   ---     -    ug   uc a      u 
5'    agcug cagu  acg  g cagcgc u
      ||||| ||||  |||  | |||||| g
3'    ucgac gucg  ugc  c gucgcg c
   ccg     c    gu   -c -      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 2693707-2693761 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9716
dvi-mir-317scaffold_12855: 2698541-2698626 [-]
dvi-mir-9716scaffold_12855: 2693707-2693761 [-]
dvi-mir-277scaffold_12855: 2684222-2684310 [-]
Database links

Mature sequence dvi-miR-9716-5p

Accession MIMAT0039305
Sequence

1 - 

agcugcaguugacgucgacagcg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9716-3p

Accession MIMAT0039306
Sequence

33 - 

cugcccguuggcugccagcugc

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).