Stem-loop sequence chi-mir-449b

AccessionMI0030795 (change log)
DescriptionCapra hircus miR-449b stem-loop
Gene family MIPF0000133; mir-449
Literature search

1 open access papers mention chi-mir-449b
(1 sentences)

Stem-loop
   --------uga  u   u     a     u   uu   a c        uu gg 
5'            cc gaa caggu ggcag gua  guu g uggcugcu  g  u
              || ||| ||||| ||||| |||  ||| | ||||||||  |   
3'            gg cuu guuca ccguc cgu  caa c accgacga  u  c
   cuucuuaaaua  u   c     -     c   --   - -        cu aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr20: 24946735-24946831 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-449b
chi-mir-449cchr20: 24945519-24945619 [+]
chi-mir-449bchr20: 24946735-24946831 [+]
chi-mir-449achr20: 24946859-24946946 [+]
Database links

Mature sequence chi-miR-449b-5p

Accession MIMAT0036232
Sequence

16 - 

aggcaguguauuguuagcuggc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-449b-3p

Accession MIMAT0036233
Sequence

57 - 

agccacaacugcccugccacuu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).