Stem-loop sequence chi-mir-449a

AccessionMI0030794 (change log)
DescriptionCapra hircus miR-449a stem-loop
Gene family MIPF0000133; mir-449
Literature search

2 open access papers mention chi-mir-449a
(15 sentences)

Stem-loop
   ----u   ug     u       -    u          u a  au 
5'      gug  auggg uggcagu guau guuagcuggu g au  g
        |||  ||||| ||||||| |||| |||||||||| | ||   
3'      uac  uauuc aucguca cgua caaucgacua c ug  u
   auaug   gu     u       a    -          c g  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr20: 24946859-24946946 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-449a
chi-mir-449cchr20: 24945519-24945619 [+]
chi-mir-449bchr20: 24946735-24946831 [+]
chi-mir-449achr20: 24946859-24946946 [+]
Database links

Mature sequence chi-miR-449a-5p

Accession MIMAT0036230
Sequence

13 - 

uggcaguguauuguuagcugg

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-449a-3p

Accession MIMAT0036231
Sequence

52 - 

ucagcuaacaugcaacugcuauc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).