Stem-loop sequence tae-MIR9678

AccessionMI0030415 (change log)
DescriptionTriticum aestivum miR9678 stem-loop
Literature search

1 open access papers mention tae-MIR9678
(2 sentences)

Stem-loop
   -     g   a    g  a        c        a  gaau     cg 
5'  cguag auc ucug cg gggacaua acuguaca gu    cgcgg  c
    ||||| ||| |||| || |||||||| |||||||| ||    |||||   
3'  gcauc uag agac gc cccuguau ugacaugu cg    gcguc  g
   a     -   c    g  -        u        c  ----     cc 
Get sequence
Deep sequencing
68 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
7D: 232631192-232631286 [-]
intergenic
Database links

Mature sequence tae-miR9678-3p

Accession MIMAT0035805
Sequence

11 - 

ucuggcgagggacauacacugu

 - 32

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).