Stem-loop sequence tae-MIR9670

AccessionMI0030395 (change log)
DescriptionTriticum aestivum miR9670 stem-loop
Literature search

1 open access papers mention tae-MIR9670
(4 sentences)

Stem-loop
   -      c              c              u 
5'  ccugaa gucuucuucaagua uccacuuuuuuuuc c
    |||||| |||||||||||||| |||||||||||||| g
3'  ggacuu uagaagaaguucau agguggaaaaagag c
   u      u              a              g 
Get sequence
Deep sequencing
669707 reads, 2.91e+03 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
6D: 50938062-50938139 [-]
intergenic
Database links

Mature sequence tae-miR9670-3p

Accession MIMAT0035785
Sequence

49 - 

agguggaauacuugaagaaga

 - 69

Get sequence
Deep sequencing7240 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).