Stem-loop sequence tae-MIR9662b

AccessionMI0030390 (change log)
DescriptionTriticum aestivum miR9662b stem-loop
Gene family MIPF0002119; MIR9662
Literature search

2 open access papers mention tae-MIR9662b
(2 sentences)

Stem-loop
   ucgg  a  -    c      cu              aa  u      ac 
5'     gg gc ccgg ggcucu  gguguucaagcagg  cc caugcu  c
       || || |||| ||||||  ||||||||||||||  || ||||||   
3'     cc ug ggcc ccgaga  cuacaaguucguuc  gg guacga  g
   -aaa  g  c    a      cc              gc  c      cg 
Get sequence
Deep sequencing
4040037 reads, 1.97e+04 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9662b-3p

Accession MIMAT0035780
Sequence

71 - 

ugaacaucccagagccaccgg

 - 91

Get sequence
Deep sequencing4018158 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).