Stem-loop sequence tae-MIR9662a

AccessionMI0030382 (change log)
DescriptionTriticum aestivum miR9662a stem-loop
Gene family MIPF0002119; MIR9662
Literature search

2 open access papers mention tae-MIR9662a
(2 sentences)

Stem-loop
   gg  a  -    c      cu              aa  u      ac 
5'   gg gc ccgg ggcucu  gguguucaagcagg  cc caugcu  c
     || || |||| ||||||  ||||||||||||||  || ||||||   
3'   cc ug ggcc ccgaga  cuacaaguucguuc  gg guacga  g
   aa  g  c    a      cc              gc  c      cg 
Get sequence
Deep sequencing
4040037 reads, 1.97e+04 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
6A: 54567486-54567582 [+]
intergenic
Database links

Mature sequence tae-miR9662a-3p

Accession MIMAT0035772
Sequence

68 - 

uugaacaucccagagccaccg

 - 88

Get sequence
Deep sequencing4018160 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).