![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tae-MIR9662a |
|||||
Accession | MI0030382 (change log) | ||||
Description | Triticum aestivum miR9662a stem-loop | ||||
Gene family | MIPF0002119; MIR9662 | ||||
Literature search |
2 open access papers mention tae-MIR9662a | ||||
Stem-loop |
gg a - c cu aa u ac 5' gg gc ccgg ggcucu gguguucaagcagg cc caugcu c || || |||| |||||| |||||||||||||| || |||||| 3' cc ug ggcc ccgaga cuacaaguucguuc gg guacga g aa g c a cc gc c cg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tae-miR9662a-3p |
|
Accession | MIMAT0035772 |
Sequence |
68 - uugaacaucccagagccaccg - 88 |
Deep sequencing | 4018160 reads, 116 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24734873
"Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)"
BMC Genomics. 15:289(2014).
|