Stem-loop sequence tae-MIR9655

AccessionMI0030372 (change log)
DescriptionTriticum aestivum miR9655 stem-loop
Literature search

2 open access papers mention tae-MIR9655
(4 sentences)

Stem-loop
   -cgggu         c      c            u        agugcgccaugccggcg 
5'       gauccgucu aggcgu ggcuacuuccuu cccuugcc                 g
         ||||||||| |||||| |||||||||||| ||||||||                  
3'       cuaggcggg ucugca ccgaugaaggaa gggaacgg                 g
   uacgau         u      a            -        acacguucuccccacgu 
Get sequence
Deep sequencing
17576 reads, 62.1 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9655-3p

Accession MIMAT0035762
Sequence

82 - 

caagggaaggaaguagccaac

 - 102

Get sequence
Deep sequencing1437 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).