Stem-loop sequence pbv-mir-214

AccessionMI0030287 (change log)
DescriptionPython bivittatus miR-214 stem-loop
Stem-loop
   u    agagu         u          aca            aacau 
5'  ggau     ugucaugug cugccugucu   cuugcugugcag     c
    ||||     ||||||||| ||||||||||   ||||||||||||     c
3'  ccua     acaguacac gacggacaga   ggacgacauguc     u
   a    -----         u          cac            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE960262.1: 19329-19426 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-214
pbv-mir-199-2KE960262.1: 14380-14470 [+]
pbv-mir-214KE960262.1: 19329-19426 [+]
Database links

Mature sequence pbv-miR-214-5p

Accession MIMAT0039018
Sequence

22 - 

ugccugucuacacuugcugugc

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-214-3p

Accession MIMAT0039019
Sequence

63 - 

acagcaggcacagacaggcagu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).