Stem-loop sequence pbv-mir-22

AccessionMI0030169 (change log)
DescriptionPython bivittatus miR-22 stem-loop
Stem-loop
   -u      ccag              -     c      c  cc c 
5'   ggcuac    cagcaguucuucag uggca gcuuua gu  c u
     ||||||    |||||||||||||| ||||| |||||| ||  | c
3'   ucgaug    guugucaagaaguu accgu cgaaau cg  g c
   cg      -cca              g     -      -  ac a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE957638.1: 96450-96539 [-]
intergenic
Database links

Mature sequence pbv-miR-22-5p

Accession MIMAT0038851
Sequence

16 - 

aguucuucaguggcacgcuuua

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-22-3p

Accession MIMAT0038852
Sequence

56 - 

aagcugccaguugaagaacugu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).