Stem-loop sequence pbv-let-7c-2

AccessionMI0030135 (change log)
DescriptionPython bivittatus let-7c-2 stem-loop
Stem-loop
   --   -       u uu   g   u              agaauaaca 
5'   gcg ugccucg g  gag uag agguuguaugguug         c
     ||| ||||||| |  ||| ||| ||||||||||||||          
3'   cgc acggagu c  uuc auc uccgacauaucaau         c
   ac   u       c cu   g   c              agaggacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE959282.1: 26477-26571 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-let-7c-2
pbv-mir-99bKE959282.1: 28262-28353 [-]
pbv-let-7c-2KE959282.1: 26477-26571 [-]
pbv-mir-125aKE959282.1: 18897-18975 [-]
Database links

Mature sequence pbv-let-7c-5p

Accession MIMAT0038798
Sequence

14 - 

ugagguaguagguuguaugguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-let-7c-2-3p

Accession MIMAT0038800
Sequence

60 - 

cuauacagccuccuagcuuucc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).