Stem-loop sequence ami-mir-194-2

AccessionMI0029778 (change log)
DescriptionAlligator mississippiensis miR-194-2 stem-loop
Stem-loop
   --cg         a    cu         a       u    gggg 
5'     cuggugucc uccg  guaacagca cuccaug ggga    u
       ||||||||| ||||  ||||||||| ||||||| ||||    c
3'     ggccacggg aggu  uauugucgu ggggugc cccu    c
   cgag         c    cu         c       -    ggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006887.1: 24474-24565 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-194-2
ami-mir-194-2AKHW03006887.1: 24474-24565 [-]
ami-mir-192AKHW03006887.1: 23368-23458 [-]
Database links

Mature sequence ami-miR-194-5p

Accession MIMAT0038212
Sequence

18 - 

uguaacagcaacuccaugugg

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-194-2-3p

Accession MIMAT0038214
Sequence

54 - 

cccguggggcugcuguuauucu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).