Stem-loop sequence ami-mir-30d

AccessionMI0029694 (change log)
DescriptionAlligator mississippiensis miR-30d stem-loop
Stem-loop
   au  g    u  u  u         ccc            u  ga 
5'   gg aguc gu gu guaaacauc   gacuggaagcug aa  g
     || |||| || || |||||||||   |||||||||||| ||   
3'   uc ucgg ca cg cguuuguag   cugacuuucgau uu  a
   --  a    u  c  u         --a            c  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000629.1: 6771336-6771423 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-30d
ami-mir-30dAKHW03000629.1: 6771336-6771423 [-]
ami-mir-30bAKHW03000629.1: 6765014-6765105 [-]
Database links

Mature sequence ami-miR-30d-5p

Accession MIMAT0038084
Sequence

16 - 

uguaaacauccccgacuggaagcu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-30d-3p

Accession MIMAT0038085
Sequence

56 - 

cuuucagucagauguuugcug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).