Stem-loop sequence ami-mir-27b

AccessionMI0029685 (change log)
DescriptionAlligator mississippiensis miR-27b stem-loop
Stem-loop
   --   -    gaca                  auug        ---u  uu 
5'   ccu cucu    aggugcagagcuuagcug    gugaacag    ga  g
     ||| ||||    ||||||||||||||||||    ||||||||    ||   
3'   gga gaga    uccacgucuugaaucggu    cacuuguu    cu  a
   gu   a    --ag                  --ga        uccc  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006358.1: 16892732-16892827 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-27b
ami-mir-23bAKHW03006358.1: 16892962-16893058 [-]
ami-mir-27bAKHW03006358.1: 16892732-16892827 [-]
ami-mir-24-1AKHW03006358.1: 16892164-16892255 [-]
Database links

Mature sequence ami-miR-27b-5p

Accession MIMAT0038069
Sequence

18 - 

agagcuuagcugauuggugaac

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-27b-3p

Accession MIMAT0038070
Sequence

60 - 

uucacaguggcuaaguucug

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).