Stem-loop sequence cpi-mir-183

AccessionMI0029507 (change log)
DescriptionChrysemys picta miR-183 stem-loop
Stem-loop
   gc   -ac  -         g      --ac     ga        ugaaaa 
5'   guu   uc cuguucugu uauggc    uggua  auucacug      c
     |||   || ||||||||| ||||||    |||||  ||||||||       
3'   caa   ag gacgagaca auaccg    accau  uaagugac      a
   -c   gaa  a         a      ggau     --        uaucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083104.1: 1276366-1276464 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-183
cpi-mir-183KK083104.1: 1276366-1276464 [+]
cpi-mir-96KK083104.1: 1276766-1276863 [+]
Database links

Mature sequence cpi-miR-183-5p

Accession MIMAT0037800
Sequence

20 - 

uauggcacugguagaauucac

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).