Stem-loop sequence cpi-mir-124-3

AccessionMI0029457 (change log)
DescriptionChrysemys picta miR-124-3 stem-loop
Stem-loop
   cga  c       - c        a   ga        uaaug 
5'    gc ccucucu g guguucac gcg  ccuugauu     u
      || ||||||| | |||||||| |||  ||||||||      
3'    cg ggagaga c cguaagug cgc  ggaauuaa     c
   -uc  a       a -        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088178.1: 4667893-4667977 [+]
intergenic
Database links

Mature sequence cpi-miR-124-5p

Accession MIMAT0037726
Sequence

15 - 

cguguucacagcggaccuuga

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-124-3p

Accession MIMAT0037727
Sequence

53 - 

uaaggcacgcggugaaugcca

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).