Stem-loop sequence cpi-mir-124-2

AccessionMI0029456 (change log)
DescriptionChrysemys picta miR-124-2 stem-loop
Stem-loop
   ---cg        a    cc        a   ga        uaau 
5'      aggcucug cucu  guguucac gcg  ccuugauu    g
        |||||||| ||||  |||||||| |||  ||||||||    u
3'      uccgaggc gaga  cguaagug cgc  ggaauuaa    c
   cgaag        -    ac        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr2: 65680050-65680140 [-]
intergenic
Database links

Mature sequence cpi-miR-124-5p

Accession MIMAT0037726
Sequence

17 - 

cguguucacagcggaccuuga

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-124-3p

Accession MIMAT0037727
Sequence

54 - 

uaaggcacgcggugaaugcca

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).