Stem-loop sequence cpi-mir-124-1

AccessionMI0029455 (change log)
DescriptionChrysemys picta miR-124-1 stem-loop
Stem-loop
   ------    --   cc        a   ga        uaaau 
5'       ccuc  ucu  guguucac gcg  ccuugauu     g
         ||||  |||  |||||||| |||  ||||||||     u
3'       ggag  aga  cguaagug cgc  ggaauuaa     c
   uaaguc    ca   ac        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
AHGY02146791.1: 117-199 [-]
intergenic
Database links

Mature sequence cpi-miR-124-5p

Accession MIMAT0037726
Sequence

9 - 

cguguucacagcggaccuuga

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-124-3p

Accession MIMAT0037727
Sequence

48 - 

uaaggcacgcggugaaugcca

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).