Stem-loop sequence cpi-mir-27b

AccessionMI0029419 (change log)
DescriptionChrysemys picta miR-27b stem-loop
Stem-loop
   ----    -    aaca                  auug        u  uug 
5'     accu cucu    aggugcagagcuuagcug    gugaacag ga   a
       |||| ||||    ||||||||||||||||||    |||||||| ||   u
3'     ugga gaga    uccacgucuugaaucggu    cacuuguu cu   u
   agag    a    --ag                  --ga        u  ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088213.1: 2615975-2616074 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-27b
cpi-mir-23bKK088213.1: 2615768-2615858 [+]
cpi-mir-27bKK088213.1: 2615975-2616074 [+]
cpi-mir-24-1KK088213.1: 2616485-2616579 [+]
Database links

Mature sequence cpi-miR-27b-5p

Accession MIMAT0037666
Sequence

19 - 

agagcuuagcugauuggugaac

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-27b-3p

Accession MIMAT0037667
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).