Stem-loop sequence cpi-mir-23b

AccessionMI0029412 (change log)
DescriptionChrysemys picta miR-23b stem-loop
Stem-loop
   uaau  ug   c   u   --          ugcugauu        aa 
5'     gu  ugg ugu ugg  guuccuggca        ugugauuu  g
       ||  ||| ||| |||  ||||||||||        ||||||||  a
3'     ca  acc aua acc  uagggaccgu        acacuaaa  u
   -ugu  gu   a   c   au          -------u        au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088213.1: 2615768-2615858 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-23b
cpi-mir-23bKK088213.1: 2615768-2615858 [+]
cpi-mir-27bKK088213.1: 2615975-2616074 [+]
cpi-mir-24-1KK088213.1: 2616485-2616579 [+]
Database links

Mature sequence cpi-miR-23b-3p

Accession MIMAT0037656
Sequence

55 - 

aucacauugccagggauuacc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).