Stem-loop sequence gga-mir-190b

AccessionMI0029340 (change log)
DescriptionGallus gallus miR-190b stem-loop
Literature search

3 open access papers mention gga-mir-190b
(3 sentences)

Stem-loop 
   -       u    cu  -             a     -   ga 
5'  cccugcc cugu  ga uauguuugauauu gguug uuu  u
    ||||||| ||||  || ||||||||||||| ||||| |||   
3'  gggacgg gaca  cu auacaaacuauaa ucaac aaa  u
   c       c    uu  u             a     c   gg
Get sequence
Deep sequencing
1329 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr25: 2120322-2120406 [-]
intergenic
Database links

Mature sequence gga-miR-190b-5p

Accession MIMAT0037546
Sequence

14 -  

ugauauguuugauauuagguug

 - 35

Get sequence
Deep sequencing1289 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-190b-3p

Accession MIMAT0037547
Sequence

52 -  

cuaaauaucaaacauauucuua

 - 73

Get sequence
Deep sequencing37 reads, 4 experiments
Evidence experimental; Illumina [2]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).