Stem-loop sequence ath-MIR826b

Accession

MI0029231 (change log)

Description

Arabidopsis thaliana miR826b stem-loop

Literature search

3 open access papers mention ath-MIR826b
(21 sentences)

Stem-loop

        g   a            c            acuuu   cagc 
5' uauga aua ucugguuuugga acgugaaaauua     uca    a
   ||||| ||| |||||||||||| ||||||||||||     |||    g
3' auacu uau aggccaaaaccu ugcacuuuuagu     agu    c
        a   c            a            ---au   auaa 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence was named MIR5090 in [1], but is unrelated to the human mir-5090 sequence (MI0017979).

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr4: 1340521-1340614 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR826b

• ath-MIR826b: chr4: 1340521-1340614 [-]
• ath-MIR826a: chr4: 1340479-1340656 [+]

Database links

• miRBase Tracker:MI0029231

Mature sequence ath-miR826b

• Accession: MIMAT0035543
• Sequence: 13 - ugguuuuggacacgugaaaau - 33
• Evidence: not experimental

References

1. PMID:24367020 "Two young MicroRNAs originating from target duplication mediate nitrogen starvation adaptation via regulation of glucosinolate synthesis in Arabidopsis thaliana" He H, Liang G, Li Y, Wang F, Yu D Plant Physiol. 164:853-865(2014).