Stem-loop sequence bdi-MIR5181e

AccessionMI0029184 (change log)
DescriptionBrachypodium distachyon miR5181e stem-loop
Gene family MIPF0001200; MIR5067
Literature search

1 open access papers mention bdi-MIR5181e
(2 sentences)

Stem-loop 
   --            a     a        u  c      c  aaauuu 
5'   uacucccuccga ccaua uaaguguc ga auuuag ac      g
     |||||||||||| ||||| |||||||| || |||||| ||      u
3'   augagggaggcu ggugu auucacag cu uaaauc ug      u
   gu            c     c        c  c      a  cuucaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 63715748-63715844 [-]
intergenic
Database links

Mature sequence bdi-miR5181e

Accession MIMAT0035541
Sequence

68 -  

cgacacuuacuguggcucgga

 - 88

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).