![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR2275c |
||||||
Accession | MI0029177 (change log) | |||||
Description | Brachypodium distachyon miR2275c stem-loop | |||||
Gene family | MIPF0000797; MIR2275 | |||||
Literature search |
2 open access papers mention bdi-MIR2275c | |||||
Stem-loop |
-a c u - u ca g 5' cuggg ag ugaa gugagau uugga ggaaccaaaucuu gcu c ||||| || |||| ||||||| ||||| ||||||||||||| ||| a 3' gaccc uc acuu cacucua aaccu cuuugguuuagaa cgg u cg a c u c ca u |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bdi-miR2275c |
|
Accession | MIMAT0035535 |
Sequence |
60 - uuugguuuccuccaauaucuca - 81 |
Evidence | not experimental |
References |
|
1 |
PMID:24367943
"Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon"
Genome Biol. 14:R145(2013).
|