Stem-loop sequence bdi-MIR2275a

AccessionMI0029175 (change log)
DescriptionBrachypodium distachyon miR2275a stem-loop
Gene family MIPF0000797; MIR2275
Literature search

2 open access papers mention bdi-MIR2275a
(5 sentences)

Stem-loop 
   g  a        g      u    -       u gg         -----    g 
5'  ag auuuggca augaau ugag uguugga g  accaaaucu     uacc c
    || |||||||| |||||| |||| ||||||| |  |||||||||     ||||  
3'  uc uagacugu uacuug acuc guaaccu c  ugguuuaga     gugg a
   g  g        g      u    u       c uu         acaua    g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 12513972-12514077 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR2275a
bdi-MIR2275a3: 12513972-12514077 [+]
bdi-MIR2275c3: 12514129-12514225 [+]
Database links

Mature sequence bdi-miR2275a

Accession MIMAT0035533
Sequence

65 -  

uuugguuuccuccaaugucuca

 - 86

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).