Stem-loop sequence bdi-MIR9496

Accession

MI0029147 (change log)

Description

Brachypodium distachyon miR9496 stem-loop

Stem-loop

   -- c    a  c     g  c            ucag     
5'   g cucu ga ugguu gg uuagaugggucc    ccgg 
     | |||| || ||||| || ||||||||||||    ||| c
3'   c gagg cu accga cc aaucuacccagg    ggcc 
   gg c    -  u     a  a            --ua     

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Bd21; GCA_000005505.1): 3: 1747940-1748017 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0029147

Mature sequence bdi-miR9496

• Accession: MIMAT0035505
• Sequence: 10 - cugguugggcuuagaugggucc - 31
• Evidence: not experimental

References

1. PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).