![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR9496 |
|||||
Accession | MI0029147 (change log) | ||||
Description | Brachypodium distachyon miR9496 stem-loop | ||||
Stem-loop |
-- c a c g c ucag 5' g cucu ga ugguu gg uuagaugggucc ccgg | |||| || ||||| || |||||||||||| ||| c 3' c gagg cu accga cc aaucuacccagg ggcc gg c - u a a --ua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR9496 |
|
Accession | MIMAT0035505 |
Sequence |
10 - cugguugggcuuagaugggucc - 31 |
Evidence | not experimental |
References |
|
1 |
PMID:24367943
"Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon"
Genome Biol. 14:R145(2013).
|