![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR9486a |
|||||
Accession | MI0029135 (change log) | ||||
Description | Brachypodium distachyon miR9486a stem-loop | ||||
Gene family | MIPF0002054; MIR9486 | ||||
Literature search |
1 open access papers mention bdi-MIR9486a | ||||
Stem-loop |
--uc - a a c - g 5' aaagg ggaa ccucuaauc cuu aaggcauuuuaugaa gaaaaaacccug a ||||| |||| ||||||||| ||| ||||||||||||||| |||||||||||| 3' uuucc ccuu ggagauuag gaa uuucguaaaauacuu cuuuuuugggac u auac a - g c u c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR9486a |
|
Accession | MIMAT0035493 |
Sequence |
79 - augcuuucaagggauuagagguuc - 102 |
Evidence | not experimental |
References |
|
1 |
PMID:24367943
"Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon"
Genome Biol. 14:R145(2013).
|