Stem-loop sequence sly-MIR390a

AccessionMI0029117 (change log)
DescriptionSolanum lycopersicum miR390a stem-loop
Gene family MIPF0000101; MIR390
Literature search

17 open access papers mention sly-MIR390a
(57 sentences)

Stem-loop
             u     u  uguucuu   gaaau           u               g       accaugaauacaucu 
5' agagaucaac augaa gu       gug     ggcauggggaa cuauaaagcucagga ggauagc               u
   |||||||||| ||||| ||       |||     ||||||||||| ||||||||||||||| |||||||                
3' uuucuaguug uacuu cg       cgc     ucguacuucuu gguauuuugaguccu ccuaucg               a
             -     -  ugguuuu   -----           c               a       cgauaucuaucggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr10: 59349779-59349941 [-]
intergenic
Database links

Mature sequence sly-miR390a-5p

Accession MIMAT0035467
Sequence

52 - 

aagcucaggagggauagcacc

 - 72

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR390a-3p

Accession MIMAT0035468
Sequence

101 - 

cgcuauccauccugaguuuua

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).