Stem-loop sequence efu-mir-449

AccessionMI0028804 (change log)
DescriptionEptesicus fuscus miR-449 stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   --  ug     c       -    u          ugg   g 
5'   ug  auggg uggcagu guau guuagcuggu   uau u
     ||  ||||| ||||||| |||| ||||||||||   |||  
3'   ac  uaccc gucguca cgua caaucgacua   gua g
   gu  gu     u       a    -          -ca   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977884.1: 459967-460047 [-]
intergenic
Database links

Mature sequence efu-miR-449

Accession MIMAT0035108
Sequence

11 - 

uggcaguguauuguuagcugguugg

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).