Stem-loop sequence eca-mir-2114

AccessionMI0028354 (change log)
DescriptionEquus caballus miR-2114 stem-loop
Gene family MIPF0001464; mir-2114
Literature search

1 open access papers mention eca-mir-2114
(1 sentences)

Stem-loop
   ug  c           -------ccau    u   u    cu        c     a  g   gauaag 
5'   gg ucagggacagg           ggcc cca gcuc  agucccuu cuuga gg ucg      u
     || |||||||||||           |||| ||| ||||  |||||||| ||||| || |||       
3'   cc aguccuugucc           ucgg ggu cgag  ucagggaa gaacu cc agc      c
   --  a           uccgacgaccc    u   -    uu        c     -  g   aguaca 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 119236745-119236873 [+]
intergenic
Database links

Mature sequence eca-miR-2114

Accession MIMAT0034714
Sequence

73 - 

agccucaagcaagggacuuuga

 - 94

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).