Stem-loop sequence eca-mir-676

AccessionMI0028342 (change log)
DescriptionEquus caballus miR-676 stem-loop
Gene family MIPF0000471; mir-676
Literature search

1 open access papers mention eca-mir-676
(1 sentences)

Stem-loop
   gaga       uu   -uccuca      -    u     uu      cg    uc   gaauu 
5'     cuucaug  ggu       ccagaa ugca gacuc  caaucu  ggac  gca     a
       |||||||  |||       |||||| |||| |||||  ||||||  ||||  |||      
3'     ggggugu  cua       ggucuu gcgu uugag  guugga  ccug  cgu     a
   ugaa       cu   cuuuacg      u    c     uu      au    -c   aaggu 
Get sequence
Deep sequencing
324 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 51938828-51938954 [+]
sense
ENSECAT00000028886 ; EDA-201; intron 4
Database links

Mature sequence eca-miR-676

Accession MIMAT0034705
Sequence

72 - 

ccguccuaagguuguugaguu

 - 92

Get sequence
Deep sequencing322 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).