Stem-loop sequence eca-mir-483

Accession

MI0028301 (change log)

Description

Equus caballus miR-483 stem-loop

Gene family

MIPF0000180; mir-483

Literature search

2 open access papers mention eca-mir-483
(7 sentences)

Stem-loop

   -----      c uu  agccu    u       c                       ---  c  g  u 
5'      gcugag c  gg     gugg gggggag gggggaggacgggaggggaggag   gg gu gu u
        |||||| |  ||     |||| ||||||| |||||||||||||||||||||||   || || || u
3'      cggcuc g  cc     uacc cuccuuc ucuucuucugcccuccucuccuc   cc cg cg a
   cucgg      u -u  guccu    -       u                       acu  u  a  u 

Deep sequencing

376 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (EquCab2.0; GCF_000002305.2): chr12: 30634767-30634899 [-]
• Overlapping transcripts:

  sense

  ENSECAT00000026377 ; eca-mir-675-201; intron 1

  ENSECAT00000026481 ; IGF2-201; intron 3

  antisense

  ENSECAT00000026368 ; MRPL23-201; intron 4

Database links

• miRBase Tracker:MI0028301

Mature sequence eca-miR-483

• Accession: MIMAT0034670
• Sequence: 75 - ucacuccucuccucccgucuucuu - 98
• Deep sequencing: 361 reads, 1 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).