Stem-loop sequence eca-mir-1249

AccessionMI0028185 (change log)
DescriptionEquus caballus miR-1249 stem-loop
Gene family MIPF0000667; mir-1249
Literature search

1 open access papers mention eca-mir-1249
(1 sentences)

Stem-loop
   guccc    -ca     uuccuca  -uucuu      gu  -         a  a  u    caa     cuc 
5'      agcu   ucuug       ga      guuugc  gg ggaggaggg gg ga gggc   guucc   u
        ||||   |||||       ||      ||||||  || ||||||||| || || ||||   |||||    
3'      ucga   agaac       cu      caagcg  cc cuucuuccc cc cu cccg   caagg   g
   -gaac    ccc     -uuccug  cauccu      gu  a         -  c  u    ---     ucc 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr28: 41193631-41193771 [-]
sense
ENSECAT00000024700 ; KIAA0930-201; intron 6
Database links

Mature sequence eca-miR-1249

Accession MIMAT0034563
Sequence

79 - 

aacgcccuucccccccuucuuca

 - 101

Get sequence
Deep sequencing56 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).