Stem-loop sequence eca-mir-449b

AccessionMI0028109 (change log)
DescriptionEquus caballus miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   --------c   ga   cagcag  a  u   u     a     u  -     uagcu       uu gg 
5'          gug  aag      ug cc gag caggu ggcag gu guugu     ggcugcu  a  u
            |||  |||      || || ||| ||||| ||||| || |||||     |||||||  |   
3'          uac  uuc      au gg cuu guuca ccguc ca caaca     ccgacga  u  c
   ugaaacaau   uc   --uuaa  a  u   c     -     c  u     -----       cu aa 
Get sequence
Deep sequencing
495 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr21: 17151814-17151938 [+]
sense
ENSECAT00000017780 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from eca-mir-449b
eca-mir-449bchr21: 17151814-17151938 [+]
eca-mir-449achr21: 17151965-17152024 [+]
Database links

Mature sequence eca-miR-449b

Accession MIMAT0034490
Sequence

31 - 

aggcaguguguuguuagcuggcugc

 - 55

Get sequence
Deep sequencing427 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).