Stem-loop sequence cfa-mir-449b

AccessionMI0028007 (change log)
DescriptionCanis familiaris miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   gccaugaaac      ----------------g  a  u   u     a     u   u  uuagc        uu  g 
5'           guagcc                 ug cc gag caggu ggcag gua ug     uggcugcu  gg u
             ||||||                 || || ||| ||||| ||||| ||| ||     ||||||||  || c
3'           cgucgg                 ac gg cuu guuca ccguc cau ac     accgacgg  cu a
   ----------      acaauuacucuucuuaa  a  u   c     -     c   c  ----c        -u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr2: 42542049-42542177 [-]
sense
ENSCAFT00000010869 ; CDC20B-201; intron 1
ENSCAFT00000010868 ; CDC20B-202; intron 2
Clustered miRNAs
< 10kb from cfa-mir-449b
cfa-mir-449bchr2: 42542049-42542177 [-]
cfa-mir-449achr2: 42541949-42542039 [-]
Database links

Mature sequence cfa-miR-449b

Accession MIMAT0034406
Sequence

73 - 

cagccaccacuacccugccacu

 - 94

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).