Stem-loop sequence ppc-mir-84e

AccessionMI0026948 (change log)
DescriptionPristionchus pacificus miR-84e stem-loop
Literature search

1 open access papers mention ppc-mir-84e
(1 sentences)

Stem-loop
   --    gu  -u       a     -   a  c 
5'   ugag  ag  uaagaau gcacu gcu uu a
     ||||  ||  ||||||| ||||| ||| ||  
3'   acuc  uc  auucuua cguga cga aa c
   cg    ug  cu       -     a   g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000031.1: 402079-402141 [-]
intergenic
Database links

Mature sequence ppc-miR-84e-5p

Accession MIMAT0033039
Sequence

1 - 

ugagguaguuaagaauagcacu

 - 22

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ppc-miR-84e-3p

Accession MIMAT0033040
Sequence

42 - 

ugcauucuuauccugucucagc

 - 63

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).