Stem-loop sequence ppc-mir-71b

AccessionMI0026931 (change log)
DescriptionPristionchus pacificus miR-71b stem-loop
Gene family MIPF0000278; mir-71
Literature search

2 open access papers mention ppc-mir-71b
(18 sentences)

Stem-loop
   --u    a   u         g    -u  gaa 
5'    gaaa acu ggguaguga acga  gu   u
      |||| ||| ||||||||| ||||  ||   u
3'    cuuu uga cuuaucacu ugcu  cg   g
   ccg    c   -         a    uu  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000107.1: 286726-286790 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-71b
ppc-mir-71aABKE03000107.1: 286429-286541 [+]
ppc-mir-71bABKE03000107.1: 286726-286790 [+]
Database links

Mature sequence ppc-miR-71b-5p

Accession MIMAT0033006
Sequence

1 - 

ugaaaaacuuggguagugagacg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-71b-3p

Accession MIMAT0033007
Sequence

44 - 

uaucacuauucagucuuucgcc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).