Stem-loop sequence ath-MIR8177

AccessionMI0026807 (change log)
DescriptionArabidopsis thaliana miR8177 stem-loop
Literature search

1 open access papers mention ath-MIR8177
(1 sentences)

Stem-loop
         uga     c      acggagagaguuaaccaacuuucauau 
5' guguga   ugugu auuuau                           a
   ||||||   ||||| ||||||                            
3' uauacu   auaca uaagua                           u
         -ug     u      auauuaaacccuugauucgguuuagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 9362559-9362655 [-]
intergenic
Database links

Mature sequence ath-miR8177

Accession MIMAT0032776
Sequence

1 - 

gugugaugaugugucauuuaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).