Stem-loop sequence ssa-mir-454

AccessionMI0026704 (change log)
DescriptionSalmo salar miR-454 stem-loop
Gene family MIPF0000174; mir-454
Literature search

1 open access papers mention ssa-mir-454
(1 sentences)

Stem-loop
   --       ---         cu       ----  u 
5'   acccuau   caauauugc  cugcuuu    uc g
     |||||||   |||||||||  |||||||    || a
3'   ugggaua   guuauaacg  gaugagg    ag c
   uc       uuc         -u       caau  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-454-5p

Accession MIMAT0032641
Sequence

1 - 

acccuaucaauauugccucugc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-454-3p

Accession MIMAT0032642
Sequence

43 - 

uagugcaauauugcuuauagggucu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1