Stem-loop sequence ssa-mir-130b-2

AccessionMI0026471 (change log)
DescriptionSalmo salar miR-130b-2 stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   u    c   u       ccu    g gacccu 
5'  gccc uuu auauugu   acug u      c
    |||| ||| |||||||   |||| |       
3'  cggg aaa uguaacg   ugac a      u
   a    a   u       ---    g aaguaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-130b-2-5p

Accession MIMAT0032326
Sequence

1 - 

ugccccuuuuauauuguccuacu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-130b-3p

Accession MIMAT0032325
Sequence

43 - 

cagugcaauguuaaaagggca

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1