Stem-loop sequence hsa-mir-6770-2

Accession

MI0026418 (change log)

Symbol

HGNC:MIR6770-2

Description

Homo sapiens miR-6770 stem-loop

Gene family

MIPF0001692; mir-6770

Stem-loop

   uauc   a            u  a  u a  u 
5'     cug gaaggcacagcu gc cg g cc c
       ||| |||||||||||| || || | ||  
3'     gac cuucugugucgg cg gu c gg c
   ----   a            -  -  c g  u 

Deep sequencing

305 reads, 0 reads per million, 77 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr16: 16329305-16329364 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000409528 ; NOMO3-001; intron 1

  OTTHUMT00000436248 ; NOMO3-005; intron 1

  OTTHUMT00000436249 ; NOMO3-003; intron 1

  OTTHUMT00000436250 ; NOMO3-002; intron 1

  ENST00000399336 ; NOMO3-001; intron 1

  ENST00000576589 ; NOMO3-005; intron 1

  ENST00000263012 ; NOMO3-003; intron 1

  ENST00000575225 ; NOMO3-002; intron 1

  ENST00000538468 ; NOMO3-201; intron 1

Clustered miRNAs

< 10kb from hsa-mir-6770-2

• hsa-mir-6511a-2: chr16: 16324588-16324654 [+]
• hsa-mir-6770-2: chr16: 16329305-16329364 [+]

Database links

• HGNC:MIR6770-2
• miRBase Tracker:MI0026418

Mature sequence hsa-miR-6770-5p

• Accession: MIMAT0027440
• Sequence: 6 - ugagaaggcacagcuugcacguga - 29
• Deep sequencing: 720 reads, 71 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6770-5p
  • miRDB:hsa-miR-6770-5p

Mature sequence hsa-miR-6770-3p

• Accession: MIMAT0027441
• Sequence: 40 - cuggcggcugugucuucacag - 60
• Deep sequencing: 192 reads, 24 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6770-3p
  • miRDB:hsa-miR-6770-3p

References

1. PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).