Stem-loop sequence stu-MIR530

AccessionMI0025981 (change log)
DescriptionSolanum tuberosum miR530 stem-loop
Gene family MIPF0000521; MIR530
Literature search

1 open access papers mention stu-MIR530
(1 sentences)

Stem-loop
   --       uu     u       ag  aac     uguu 
5'   ucugcau  gcacc gcaccuu  ug   gaauu    a
     |||||||  ||||| |||||||  ||   |||||    g
3'   agacgua  cgugg uguggaa  ac   cuuaa    c
   ac       cu     u       ag  gua     uaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137965.1: 575880-575960 [+]
intergenic
Database links

Mature sequence stu-miR530

Accession MIMAT0031330
Sequence

1 - 

ucugcauuugcaccugcaccu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).