Stem-loop sequence stu-MIR160b

AccessionMI0025956 (change log)
DescriptionSolanum tuberosum miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention stu-MIR160b
(9 sentences)

Stem-loop
   --   c       c          a    -u   -c     c 
5'   ugc uggcucc uguaugccac cacu  uca  caauu u
     ||| ||||||| |||||||||| ||||  |||  |||||  
3'   acg accgagg gcgugcggug guga  agu  guuag u
   au   a       a          g    cu   ca     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138023.1: 757259-757340 [-]
intergenic
Database links

Mature sequence stu-miR160b

Accession MIMAT0031285
Sequence

1 - 

ugccuggcucccuguaugcca

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).