Stem-loop sequence stu-MIR319a

AccessionMI0025952 (change log)
DescriptionSolanum tuberosum miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

1 open access papers mention stu-MIR319a
(10 sentences)

Stem-loop
   --a     uu          cac         ga    gu        --  g   ac       uc  aa         ----c   a 
5'    gagcu  cuucggucca   auggggggc  uagg  ucaauuug  cu ccg  ucauuca  ca  uguugaggu     uug u
      |||||  ||||||||||   |||||||||  ||||  ||||||||  || |||  |||||||  ||  |||||||||     ||| a
3'    cucga  gaagucaggu   uguccuucg  guuc  aguugaac  ga ggc  aguaagu  gu  acgacucca     agc g
   ucc     gg          uca         -a    ug        au  g   ga       ga  ca         ccgua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137840.1: 1381096-1381267 [+]
intergenic
Database links

Mature sequence stu-miR319a-5p

Accession MIMAT0031277
Sequence

1 - 

agagcuuucuucgguccacac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR319a-3p

Accession MIMAT0031278
Sequence

152 - 

uuggacugaagggagcucccu

 - 172

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).