Stem-loop sequence stu-MIR395i

AccessionMI0025947 (change log)
DescriptionSolanum tuberosum miR395i stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention stu-MIR395i
(9 sentences)

Stem-loop
   --       ug c       u  u   u   uaacu 
5'   guucccu  a cacuuca ga ggu uaa     u
     |||||||  | ||||||| || ||| |||      
3'   caagggg  u gugaagu cu ccg guu     c
   cu       gu u       c  c   u   uuuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH139101.1: 2451-2522 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR395i
stu-MIR395hJH139101.1: 2286-2357 [+]
stu-MIR395iJH139101.1: 2451-2522 [+]
Database links

Mature sequence stu-miR395i

Accession MIMAT0031270
Sequence

52 - 

cugaaguguuugggggaacuc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).