Stem-loop sequence stu-MIR395f

AccessionMI0025944 (change log)
DescriptionSolanum tuberosum miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention stu-MIR395f
(4 sentences)

Stem-loop
   --       ug c       ug       ---  uu 
5'   guucccu  a cacuuca  agggcuu   ac  c
     |||||||  | |||||||  |||||||   ||   
3'   caagggg  u gugaagu  ucccgaa   ug  g
   cu       gu u       ca       guu  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138865.1: 14956-15024 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR395f
stu-MIR395fJH138865.1: 14956-15024 [+]
stu-MIR395gJH138865.1: 20451-20525 [+]
Database links

Mature sequence stu-miR395f

Accession MIMAT0031267
Sequence

49 - 

cugaaguguuugggggaacuc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).