Stem-loop sequence stu-MIR395b

AccessionMI0025940 (change log)
DescriptionSolanum tuberosum miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention stu-MIR395b
(9 sentences)

Stem-loop
   --       ug c       ug    -au   uuuc 
5'   guucccu  a cacuuca  aggg   uaa    u
     |||||||  | |||||||  ||||   |||    u
3'   caagggg  u gugaagu  uccc   guu    c
   cu       gu u       cg    guu   uuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137931.1: 852079-852150 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR395b
stu-MIR395bJH137931.1: 852079-852150 [-]
stu-MIR395aJH137931.1: 851903-851974 [-]
Database links

Mature sequence stu-miR395b

Accession MIMAT0031263
Sequence

52 - 

cugaaguguuugggggaacuc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).