Stem-loop sequence stu-MIR5303h

AccessionMI0025928 (change log)
DescriptionSolanum tuberosum miR5303h stem-loop
Gene family MIPF0001432; MIR5303
Literature search

3 open access papers mention stu-MIR5303h
(7 sentences)

Stem-loop
   --     a     c     u     ccgcacuc    c      u      aaga 
5'   gcuca acucu caaaa uguug        gugu ggaucc ccaaaa    g
     ||||| ||||| ||||| |||||        |||| |||||| ||||||    c
3'   cgagu ugaga guuuu acaac        caca ccuagg gguuuu    a
   aa     c     a     u     --uucuca    a      u      cauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138058.1: 671120-671228 [-]
intergenic
Database links

Mature sequence stu-miR5303h

Accession MIMAT0031243
Sequence

86 - 

aacauuuuugaagagucugagcaa

 - 109

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).