Stem-loop sequence stu-MIR164

AccessionMI0025882 (change log)
DescriptionSolanum tuberosum miR164 stem-loop
Gene family MIPF0000045; MIR164
Literature search

7 open access papers mention stu-MIR164
(47 sentences)

Stem-loop
   --      a  -           u     a      acuu 
5'   uggaga gc agggcacaugc gaauu cuugaa    u
     |||||| || ||||||||||| ||||| ||||||     
3'   accucu cg ucucguguacg uuuaa gaacuu    g
   cg      -  a           u     -      auua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138033.1: 603264-603340 [+]
intergenic
Database links

Mature sequence stu-miR164-5p

Accession MIMAT0031235
Sequence

1 - 

uggagaagcagggcacaugcu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR164-3p

Accession MIMAT0030973
Sequence

57 - 

caugugcucuagcucuccagc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).