Stem-loop sequence stu-MIR319

AccessionMI0025861 (change log)
DescriptionSolanum tuberosum miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention stu-MIR319
(10 sentences)

Stem-loop
   --   a    g          ccc    ug guuauu        u   u   g   a        cu  u         aaagaa    a 
5'   agg aacu uuuaguccaa   aagg  g      ggaacuga cuu gcu cug aucauugg  ca gagcauguc      gaug a
     ||| |||| ||||||||||   ||||  |      |||||||| ||| ||| ||| ||||||||  || |||||||||      |||| u
3'   ucc uugg aagucagguu   uucc  c      uuuuggcu gag cga gac uaguaacc  gu cuuguacag      cuac a
   cu   c    g          cuu    gu ---acu        c   u   g   g        uc  u         ---guc    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137816.1: 1868464-1868640 [+]
intergenic
Database links

Mature sequence stu-miR319-5p

Accession MIMAT0031219
Sequence

1 - 

aggaaacuguuuaguccaacc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR319-3p

Accession MIMAT0030952
Sequence

157 - 

uuggacugaaggguucccuuc

 - 177

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).